Effectiveness of your marketing plan Essay

There are a few quantifiable elements that Under Armor can use in order to evaluate, monitor and control the effectiveness of the marketing plan. One way is that a company can, is to take a look at there sales over different time periods. After looking at sales in increments of every two months or every six months, they would be able to determine the effectiveness. If it shows during certain times of the year they are saleing more then other times, and then they can see if there marketing changes helped or not. Another way that we can determine the effectiveness of the marketing plan for Under Armor is to have surveys that consumers can take. These surveys should be able to be taken online as well has when they purchase the product. This helps for the marketing team can see how consumers feel about the product. That way consumers can feel like they have some part in the product and it also helps the marketing team to make more precise changes. The more precise changes means that they can get right to the point of turning a profit and making the consumer happy. With that also being said happy consumers means loyal customers and constant profit. SWOT is also another quantifiable element that needs to be used with any company. SWOT helps to take a look at the in and outs of the marketing environment which helps to show what type of trends the Under Armor consumers are purchasing it at. SWOT is great because it looks at other marketing skills and any changes that way changes can be made as soon as possible and they can start to see better numbers or even just steady numbers. Making marketing changes always help to create more of an opportunity for a product that is trying to be sold. More opportunities mean more consumers and the better the profit. If the company is able to make changes for the better then that means that they are keeping there consumers happy and that helps with the word of mouth for the company and the products they are trying to sale. Resources: http://search.proquest.com.ezproxy.apollolibrary.com/docview/200554736?accountid=35812 McDonald, M. (2010), â€Å"A brief review of marketing accountability, and a research agenda†, Journal of Business & Industrial Marketing, Vol. 25 No. 5, pp. 383-94.

Keats and Shelley

The works of Keats and Shelley have attracted the attention of many scholars of English literature. In this essay, an attempt is made to compare the literary works of John Keats and Percy Shelley. This comparison is relevant due to the fact that both the poets were the contemporaries.John Keats can be considered as belonging to the Romantic school in English literature because he wrote many poems regarding the importance of love which he considered as the basis of living as without love there is no goal for human existence. This indicates the spirit for life possessed by Keats. In some of his poems Keats expressed his love for the lady who becomes the central character of his poems.   However, there are also poems which reflected the sadness, melancholy and utter despair and hopelessness regarding the human existence. This can be experienced by the study of his poem â€Å"Ode on Melancholy†.This poem demonstrates the fact the human pleasure is temporary and it is susceptible to miseries and pain. In this poem, Keats seems to suggest the temporary nature of happiness and that life is illusion as always it is not possible to achieve what one desires. On the other hand in his â€Å"Ode on a Grecian Urn† there is a different feeling expressed by the poet. In this poem Keats is full of happiness and positive feelings as he believes that life is full of happiness and it is beautiful. In this poem, several times there is the use of the word ‘happy’ which indicates the mood of the poet while writing this poem.In fact his â€Å"Ode on Melancholy† and â€Å"Ode on a Grecian Urn† shows the two different views. Nevertheless, they also reflect the reality of life. Thus, Keats expressed both positive and negative feelings in his poems. These two different poems seem to indicate the contradictory nature of his poems. Nevertheless, melancholy is required to realize the value of happiness. Hence, in order to fully appreciate happiness or joy one should be aware of melancholy as well.One can even find the fact that melancholy is in fact necessary to enjoy the experience of happiness. Hence two different poems have been composed by Keats to fully appreciate joys and problems in life. The poems of Keats remind us that after all we are humans and that humans are mortals. Keats also speaks about the inevitability of death and he romanticizes the pleasure of painless death.(Victoria, 2000)Keats’s â€Å"Ode on a Grecian Urn† and Shelley’s â€Å"Ode to the West Wind† were composed during the same year. Being Romantic poets the critics might expect both of them to express the same feelings. However, both the poems give different messages. Shelly seems to believe in change and hence always there is hope as misery should be followed by happiness just like there are different seasons.Thus, Shelly is more positive and hopeful of the present world although he accepts that there is both melancholy an d happiness in one’s life. Keats seems to believe in static life and life without much of activities while Shelly believed in life full of motion, change and dramatic developments. The changes in nature are represented in his poem. Here for Shelly wind becomes symbolic expression of motion and change.The poet is also optimistic of death because when there is death, there is birth also. Shelly seems to believe that change is life and life is change. Shelly speaks of god of change although this god of change may mean of god of destruction. This implies that he respects even the negative developments in the human life. This is proved by the fact that the poet even welcomes death because it is followed by birth and thus there is hope even in death. Thus, when compared with Keats, Shelley is more optimistic of life with motion and he enjoys both good and bad experiences in life. He claims to be a product of autumn.He knows the happiness and melancholy of an autumn creature. For Ke ats beauty is seen in the stillness of the urn. He enjoys the motionless life of the urn. In the work of Keats there is reference to the melancholy life. In spite of these differences, in their different poems, both Keats and Shelley discuss regarding the hidden meaning of silence which is described by the use of different expressions. (Victoria, 2000)Although both Keats and Shelly belonged to the school of Romanticism in English literature and although they wrote the poems during the same year, there are significant differences between their poems â€Å"Ode on a Grecian Urn† and â€Å"Ode to the West Wind†. While Keats expressed his love for stillness, Shelly considered life as full of motion and action.Bibliography(2000). â€Å"Discussion Questions about the Poetry of Keats and Shelley†, The Victorian Web Before Victoria: Selected Authors from the eighteenth and nineteenth centuries, Retrieved online on 30-08-2005 from http://www.victorianweb.org

LITERATURE REVIEW ASSIGMENT Assignment Example | Topics and Well Written Essays - 750 words

LITERATURE REVIEW ASSIGMENT - Assignment Example This chronic condition is managed using two medical therapies; that is pharmacological and non-pharmacological management. Pharmacological therapy manages the condition within the hospital setting. The patient is put under medication and machine monitors to manage the condition. On the other hand, the non-pharmacological therapy is confined to patient education and intensive surveillance activity; emphasis is put shifting care from hospital to a primary care setting. Numerous studies have been conducted to examine which of the two therapies manage the condition more effectively. These studies have shown that patients that comply with non-pharmacological recommendations reduce the risk of death caused by this condition. Compliance can be defined as the extent to which congestive heart failure patients’ behavior, in terms of managing the condition, are in line with those of a medical practitioner or health provider (Martje et al 2010). The non-pharmacological recommendations inc lude diet,fluid restriction, weighing and exercising. The studies that were conducted included an 18 month follow up of the patients after they were discharged from hospital. The compliance ratings of pharmacological recommendations range from 10% to 70% while those of non-pharmacological recommendations range between 12 % and 75%. Approximately 48% of the patients who comply with the non-pharmacological recommendations fully comply with all the four recommendations.An individual tally of the recommendations compliance reveals that about 80% of patients comply with weighing; 90% comply with diet and fluid restrictions (Holst, et.al 2008); and about 60% comply with exercises. In elderly patients, compliance with the non-pharmacological recommendations prevents the reoccurrence of heart failure (Martje et al 2010). Patients who comply with these recommendations have fewer recommendations than non-compliant patients and those that spend in hospital are few. Patients who comply with the exercise and daily weighing recommendations often elongate their lives compared to those who don’t.This compliance also reduces the heart failure readmission. Isotonic exercise training has proven to have a positive effect on congestive heart failure patients, according to a study conducted on 30 male patients (Larsen, et.al. 2001). Total compliance of the recommendations also reduces the rate of readmission due to heart failure by 56.2%. This figure may not be statistically significant but it ascertains that close follow-up of patients will reduce the likelihood of being readmitted due to heart failure (Rich, et.al. 1995). In addition, relaxation therapies have a positive psychic effect in older patients. It reduces the psychological distress, depression in particular, among the patients (Yu, et.al p. 78). It has been discovered that patients whose levels of sodium intake are high have a high chance of being readmitted. This means that sodium intakes levels are consistent w ith the rate of readmission among the patients (Alves, et.al. p.446; Brooke, et.al. 2009). If heart failure patients begin using ACE-inhibitors during their stay in hospital, then their cognitive performance is expected to improve independently (Zuccala, et.al. p. 230). The main question of this topic is whether

2 imaginary companies merge Case Study Example | Topics and Well Written Essays - 2000 words

2 imaginary companies merge - Case Study Example me in running specific errands such as picking children from schools, picking friends from specific locations and in large scale, GoogLexus is projected to be useful for the taxi business where cars can be sent to collect clients from different locations without involving drivers (Toyota/Lexus 2012). The GPS system will be fitted with the camera that will allow the operator to monitor the events as they happen in the car from a sitting. This will be the first time to develop such GPS system devise in the history of the modern technology, therefore, there are high expectations that this product will perform favorably in the market. The main problem facing this project is how to sell it to the masses because it is a new idea and with the skeptic nature of the masses, it thought that there is a possibility of the project hitting a snug. Irrespective of these challenges, the reputation of these two companies will be vital for the success of this new GPS system device. Lexus Company was founded during early 1980s; however, it was launched in the year 1989. Lexus is associated with high quality, luxury, and customer satisfactory cars; these are the virtues behind their success. Lexus is a subsidiary of the legendary Toyota family that is reputed to be the third in the world as far as auto motive maker is concerned. In the United States of America alone, Lexus and Toyota boast of employing more than 31,000 people. In addition to this, they also employ over 160,000 individuals as dealers and suppliers. Furthermore, the total investment of Toyota in United States is approximated to be a massive $12 billion. Lexus and Toyota contribute remarkably towards the growth of the ever-growing United States economy (Toyota/Lexus 2012). The success of this product will rest upon the GPS; therefore, it is important to have background information about it. GPS in full is Global Positioning System; it is a navigation system that is based on satellite. The system comprises of 24

Twice More to the Lake, My Lake Essay Example | Topics and Well Written Essays - 500 words

Twice More to the Lake, My Lake - Essay Example I could not stop thinking. I was there on the water while it was peaceful and statue still. The atmosphere was convent quiet and it was so reassuring while I was thinking that some part of the US had become polluted with the large numbers of factories in the city. The air was fresher on the Walloon Lake than Florida. I looked at my family and they were so thrilled. My father and mother were holding hands together and genuine smiles were painted on their faces while watching over the kids enjoying the water. At last, paper work was over and it’s a big break for my parents to rest from their exhausting day jobs. Of course, it’s a perfect time for me and my siblings to forget our homework. It was a perfect time to forget the city noise. We were all ecstatic. The next day we went jet skiing and tubing on the Walloon Lake. It had so much open space to enjoy the ride and I could see the beautiful shorelines with crystal clear water kissing the shore. I and my siblings was spinning circles in the water while the sun was shining upon us again. It was a bit scorching but it was a lot of fun. It was a life full of memories. I remembered when my father taught how to drive a jet ski few years ago. I was a bit nervous as I was afraid of the deep, but that fear was gone when I first cruised the water maneuvering the jet ski myself. The placidity of the Walloon lake took out the fear completely and it would go wild as I had started to conquer the open space of the water. My family waved their hands on me. I was like a professional surfer while the fans were watching me with awe. Crushing the waves underneath was something I couldn’t forget my whole life. I felt the wind and water on my face and I felt so much freedom with what I did. Our annual visit here on the Walloon Lake is something that strengthen the bond of the family. There were

Marketing Essay Example | Topics and Well Written Essays - 2000 words - 10

Marketing - Essay Example It thus makes sense to have a bank with a global reach that makes it easy for the expats to access their money in the right currency and amount whenever need arises. Such banks include Barclays, HSBC, City Bank among others (Czinkota and Ronkainen, 2007, p. 119). One of the main reasons expats would be interested in a global bank is that one can have all the information concerning their accounts at all times. Most global banks offer international accounts accessible from any part of the world. This easiness of information access is one reason expats need to consider global banks. They get to know all the charges incurred in all the transactions they make on their accounts. Another reason a global bank is the right choice for expats is that they have the added advantage of not only accessing their money whenever they need it, they also get it in whatever currency they desire. Due to the bank’s global reach, exchange rates are also deemed to be reasonable as they are normalized all across its branches (Czinkota Ronkainen, 2007, p. 77). It also occurs that due to their large sizes, these banks have the luxury of offering the best exchange rates on the market since they enjoy economies of scale. Thus, they make profits depending on volume in spite of exorbitant rates. The expat also gets to build their banking reputation with the given bank thus improving their credit ratings. This is most important when one requires a loan to finance a given project in the new country but is short of funds. Since they have good credit ratings with their banks, they easily qualify for loans without much of a hassle. It is a great way of getting things done. A great advantage with having a global bank is that most of them offer a safe haven for one’s cash. Due to these banks’ sheer size, they are very reliable in terms of the safety of funds. Most of them have been in operation for more than a century and have this most enviable reputation for dependability. The ir big sizes also offer excellent ways for tax efficiency given that they mostly normalize their operations across all branches the world over. It is thus to the benefit of the expat to have such an institution at their service whenever they travel around the world. Besides offering peace of mind, these banks enable the expats focus on other matters while they take care of the monetary matters (Czinkota and Ronkainen, 2007, p. 103). Financial Services That Might Interest Expats Living in Hong Kong and Singapore C5.2 tabulates countries, according to rank, basing on a few selected factors. Among them is the longevity of residence in a foreign country, earning and saving for the expats, the luxury facilities in these countries available to the expat and the cost of accommodation compared to the expats’ domicile. The financial services that would most interest an expat are the earning and saving capabilities, the availability and affordability of luxurious facilities and the cos t of accommodation. The expats’ ability to earn and save money in the new country is of great importance. This depends greatly on the cost of living. If the cost of living in a country is low compared to the amount of money to be earned as an expat working there then that country is deemed to attract a lot of foreigners working and living there. India, Singapore and Hong Kong have the highest rating in this area owing to the low

Focus on Society Essay Example | Topics and Well Written Essays - 500 words

Focus on Society - Essay Example The point that needs to be taken into consideration is that no other art form is so fervently associated with economics and business as films. So, by necessity a film has to retain a delicate balance between expressing social realities so that the viewers may relate to it, while at the same time being artistically creative and involving, thereby addressing the commercial constraints and expectations (Curran, 1998). Cinema is an art form with a very large scope, canvass and budget. Yet, it is also a medium endowed with a greater responsibility towards society as compared to other art forms. So films do get influenced by the social context in which they are created, though the vivid blend of imagination, reality, glamour, intensity and conflict presented in them never fails to directly or indirectly influence the viewers in varying proportions (Hayward, 2000). It will be really relevant to talk about the 1994 comedy-drama Forrest Gump. The film, revolving around the life of a simpleton from Alabama, Forrest Gump, in a way presents the important social, popular and historical issues and events of the 20th century America. Yet, the film did not portray the American history with the simplicity of a school textbook.

Commercial aviation management functions Essay Example | Topics and Well Written Essays - 1500 words

Commercial aviation management functions - Essay Example This approach to pricing management came about as a response to the liberalization of air transport that led to high competition among service providers. Aviation companies realized that they could increase their revenues by selling the same seats in an airplane to customers based on what they were willing to pay, â€Å"as opposed to using unit cost as the only factor in pricing† (Shy, 2008, p.23). Yield management started as an analysis of variable demand but it grew to an advanced stage of complexity where it now seeks to determine how customers respond to pricing (Hayes & Miller, 2010). Yield management brings about a number of related benefits to commercial aviation. First, it increases revenue without increasing the cost of providing services (Quain & LeBruto, 2010). The revenue comes from selling units produced but not consumed under the unit based pricing model. The second advantage of yield management is that it brings about increases in profits, and not just gross sales (OFallon & Rutherford, 2010). In fact, the overall increase in gross sales in usually marginal compared to the percentage increase in profits. Without it, the seats sold under yield management would bring in zero revenue. The third advantage of using yield management is that it makes it possible for commercial aviation to â€Å"maximize revenue from available capacity† (Rouse et al., 2010, p.57). Commercial airlines sell seats that they would have flown unoccupied at low cost hence they get extra revenue. Finally, it assures revenue despite cancellations when one of the conditions for l ow fare tickets includes a non-refund policy (Button, 2010). Under most unit-based costing systems, refund policies lead to loss of revenue if buyers request for a refund. Yield management in commercial aviation has two objectives. These are, â€Å"to get the best average fare (‘yield’) possible†, and secondly, â€Å"to fill

Importance of Organizations to find our the Needs and Wants of its Essay

Importance of Organizations to find our the Needs and Wants of its Customers - Essay Example Here, both qualitative (focus groups) and quantitative research (survey) methods can be applied to gain information on whether it is important for organizations to seek out customer’s needs and wants about a particular service in the market. Our needs make up our survival kit while wants are the desires we have towards a particular good or service. According to (Davies 2005 pp98), most of our needs and wants are satisfied by products and services in the market once we purchase them. For full customer satisfaction, it is important for the providers of these services to have knowledge of what sells best in the market for the customer to go for. In order to achieve this knowledge, marketing research has to be done by the various companies providing these services in order to understand the choice and preferences of its customers in order for the company to compete effectively in the market. The following are some of the differences between the two research methods commonly used t oday. Some of the differences between qualitative and quantitative research methods Qualitative research seeks out the why but not how things happen throughout the analysis of unstructured information. It does not rely on the numbers or statistics like in quantitative research. ... On the other hand, quantitative research methods will try to collect information in the form of numbers. For instance in the Nashville international airport industry, the researcher uses the functional independence measure commonly abbreviated as FMI to collect information on the passengers functional abilities from the time the customer enters the airport until he/she leaves the airport (Holloway & Plant 2004). Qualitative research is used to gain insight in to people’s behavior, their attitudes towards a particular airline, their motivations, concerns and lifestyles. After collecting data the researcher seats back then interprets the information received. For instance in the southwest airline, the researcher can ask questions like: do you take long before our staff serves you? How do you find cleanliness in our company? Is our airline secure for you to travel with? After getting feedback from these passengers, the researcher now seats down then interprets the information fro m the answers provided by the customers. Quantitative research deals with quantities of things and involves measured of these things. For instance, a group of passengers in the Nashville international airport taking a flight to the same destination say from London to New York. Here, information is gathered by use of objective measurements or even the functional assessment tools (Litosellite 2004). Focus groups Vs. Surveys According to (Kolb 2008) there is a debate as to which type of research is best by many marketing firms. Is it better to carry out a survey in our company or will the focus groups provide the required answers to our success? The difference between the two is that focus groups are a qualitative research approach while the survey form part of the quantitative

George cantor. infinite numbers Essay Example | Topics and Well Written Essays - 1000 words

George cantor. infinite numbers - Essay Example Cantor had the passion of becoming a mathematician and in 1862; he joined University of Zurich (Putnam, 10). Cantor later moved to the University of Berlin following the death of his father. Here, he specialized in mathematics and physics and this institution gave him the chance to interact with great mathematicians such as Weierstrass and Kronecker bringing him closer to his career as a mathematician (Putnam, 12). After graduating from the university, he ended up becoming an unpaid lecturer since he could not secure himself a stable employment. In 1874, he got a position as an assistant professor at the University of Halle. It is in this same year that he married. His intensive research and analysis in mathematics had not ended yet and it is during this same year that he published his first article on set theory. In his research on set theory, Cantor dug deep into the foundations of infinite sets, which interested him most. He published a number of papers on set theory between 1874 and 1897 and come to the end of 1897; he was in a position to prove that integers in a set contained equal number of members to those contained in cubes, squares and numbers. He also provided that the counts/numbers in a line which is infinite needs to be equal to the points in a line segment in addition to his earlier statement that values which cannot be used as solutions to algebraic equations such as 2.71828 and 3.14159 in transcendental numbers will be extremely bigger than their integers. Before these provisions by him, the subject of infinity used to be treated as revered. Such a view had been propagated by mathematicians such as Gauss who provided that infinity should only be used for speaking purposes as opposed to being used as mathematical values. However, Cantor opposed Gauss’s argument saying that sets are complete number of members. In fact, Cantor went ahead and termed infinite numbers to be transfinite and as a result came up with completely new discoveries (J oseph, 188). Such discoveries saw him promoted to be the professor in 1879. Kronecker opposed Cantor’s argument on the basis that only â€Å"real† numbers may be termed to be integers terming decimals and fractions as irrational with the interpretation that they were not elements of consideration in mathematics’ business. However, some other mathematicians such as Richard Dedekind and Weierstrass supported Cantor’s argument and responded to Kronecker proving to him that Cantor was actually right. Kronecker’s opposition did not stop or delay Cantor’s work and in 1885, he extended his theory of order types and cardinal numbers in such a way that his previous theory on ordinal numbers gained some special importance. The extension was followed by the article he published in 1897 that marked his final treat to the theory of sets. As a conclusion, Cantor elaborated on the operation of set theory. He provided that if X and Y are unique sets which a re equivalent to a subset of Y and Y is equivalent to a subset, say subset X, then X and Y must be equivalent. This provision on set theory received great support from many mathematicians such as Schrat and Bernstein, making it the most prominent and his greatest contribution to mathematics. Following this provision, Cantor’s work and contribution in mathematics went down and almost ceased.

Women in the Renaissance Essay Example for Free

Women in the Renaissance Essay â€Å"What was life like for Renaissance women? † â€Å"If you were a woman in that time, would you have liked it? † and â€Å"How was the treatment towards women? † Questions like these keep pestering my mind as I research about the Renaissance. It is preposterous at how little freedom women were given compared to this day and age. Not only that, it is clear and obvious that men in the 14th to 16th century in England were given special privileges, while females were not. This is absurd. Women should have been treated as equals with men and without inferiority. The English Renaissance was a period of time filled with great injustice, harsh treatment, and unfair consequences. The life that most women live currently is a luxury compared to the Renaissance since females may major in whatever career she wants, choose who she wants to marry, and in general, make her own decisions. Yet, it has not always been this way. In the Renaissance, females were deemed inferior to males and there were laws that restricted women’s rights. For example, Protestantism â€Å"underscored women’s wifely and maternal roles and simultaneously closing down religious orders that had heretofore offered women a realm for their exercise of spiritual and social power† (Smith 25). Men could not even give females any power, even if was just religious powers. Any authority for females was looked down upon, for men believed women would misuse it since â€Å"as inheritors of eve’s sinfulness, women were pronounced disobedient, lustful, and physically foul† (Smith 25). Females were assumed that way so thus were the inferior gender and treated differently. As males were superior, it was accepted that they had the higher authority so their wives and daughters followed his orders. The daughters had no say to who her father married her to. The main purpose of daughters was as a bride. If they could not marry or lacked the dowry to become nuns, they had to find work (â€Å"Women† 324). Almost all girls were not allowed to decide who they could wed. Their father mainly chose the groom and marriages were often a matter of business. It did not matter whether or not his daughter loved the guy. In addition, the fathers expected â€Å"certain values for girls: chastity, obedience, and silence† These were thought to prepare daughters for their second stage of life, as a wife (â€Å"Women† 324). Chastity was needed because girls could not be married without it, obedience for listening to the betrothed, and silence to not argue with the husband. Sometimes, young girls married men twice or three times their age (â€Å"Women† 324). Imagine having a spouse as old as one’s father, or worse, grandfather! In nobles, the girls had their husbands chosen already at the age of ten or eleven. After five or six years, on the actual wedding, they would meet each other for their first time (â€Å"Women† 324). They were usually married to men with power and wealth; the main reason of the wedding meant sharing a lord’s property or a noble name and continued success. Many women married men they barely knew, or never met. After following her father’s orders, she then had to obey the demands of her new husband (â€Å"Women† 324). Women in the family had different roles depending on what social class they were. The roles of mostly upper class women consisted of different struggles than that of lower class women. For example, upper class women were, â€Å"placed [with] crippling limitations [on] developing artistic or intellectual skills a woman might possess† (â€Å"Women in the Renaissance†). If a woman had sophisticated abilities and wealth, there were more marital offers that came from other nobles. Also, the girls, from a young age, were taught needlework, etiquette, and other talents. In the lower classes, women tended to have â€Å"less freedom of movement in lower classes; they were always handicapped by the physical strains and dangers of constant childbearing and by endless hard labor to provide for [the] family† (â€Å"Women in the Renaissance†). Most of the lower class had to do all their work themselves instead of hiring helping hands or servants since the majority could not afford it. All the cooking, shopping, and cleaning were usually done by the females. They had no time for etiquette and needlework but for other labors in the household. Marriage in households was not the best either. â€Å"Man ruled, women was his property, and he was free to humiliate, strike, and even murder her† (Gail 40). That sounds harsh but it happened. The husbands were even able to murder their wives if their wives were caught in adultery. Adultery was consistently viewed as a wife’s crime; punished by execution and viewed as treason† (â€Å"Women† 317). It was not unheard of for the husband to kill her since divorce did not exist. It seemed that it was always the wife’s fault for seducing other men (â€Å"Adultery†). Regularly, men engaged in sexual relations outside marriage without having to be killed. Women were often married as a matter of business and not by love so of course they would be unhappy and unsettled in their relationships with their husbands. Most tended to simply submit their lives and deal with the marriage. Others refused to accept their fate and looked to satisfy their own desires elsewhere. Yet, â€Å"for a woman who gives into her desires is thought to be deviant; however, the male supremacy in early modern England only perpetuates the female desire to be unbound by societal expectations† (â€Å"Adultery†). Would it not be frustrating to have to be with a man one did not love? Since males controlled females, it was only predictable that women would want to rebel. There were women who wanted to express their opinions but in other ways. The only way â€Å"women could rise [was] through education and struggle† (Gail 42). It was only reasonable that women could finally be noticed through their intellectual abilities. However, â€Å"most men of the day, including churchmen, scholars and educators, stood together against women, and constantly spoke of them with contempt† (Gail 42). Males believed it ridiculous for women to be able to have a formal education instead of learning how to be a proper wife. In spite of all this, the Renaissance was known as the time of the rise of women. It was Spain that â€Å"was known as the country of learned women† due to the Saracen influence (Gail 42). The Saracen women were â€Å"granted spiritual equality to men and women† because of the Prophet Muhammad, whose followers invaded Spain in 711 (Gail 42). Juan Luis Vives, a tutor in Spain, educated Queen Isabella’s four daughters and then traveled to England, where he stirred interest for educating girls (Gail 43). He published books that supported schooling for girls. He began this idea and others took it up. The notion of having almost all females literate was a new thing. Not everyone agreed but there was a slight change. â€Å"During the Renaissance women lost economic power, but, at least briefly, gained status and opportunities for education† (â€Å"Did women have a renaissance? †). The women would finally have literacy instead of lighter, more informal material. Not only that, the time of questioning of women’s inferiority was the beginning of â€Å"Querelles des Femmes,† or the disputes about women (â€Å"Women† 325). â€Å"The educated daughters of humanists, businessmen, and clergy wrote to counter arguments for female inferiority and subordination to men† (Nym Mayhall 45). The women were finally taking actions for their treatment. No more would they keep waiting on men. One such woman was Christine de Pisan who wrote Livre de la cite des dames, or Book of the City of Ladies (Nym Mayhall 45). This was the first important impact of a woman to this discussion. Pisan argued about the schooling and training of women and how it was what made them inferior to men. Not only that, she disputed that â€Å"women’s subordination resulted not from women’s natural inferiority but from men’s envy of women’s virtue† (Nym Mayhall 46). Men know what females can achieve and feel threatened by the competition! That is why there is subordination between the genders. Other European women elaborated upon these opinions. Some include the French writer Marie de Gournay, British playwright Aphra Behn, and Venetian poet Lucrezia Marinella (Nym Mayhall 46). Many early feminists wrote texts that â€Å"contradict[ed] notions of women’s inferiority inherited from classical authors and Christina texts and arguing that women were fully human, not restricted by their natures or biology† (Nym Mayhall 46). This led more females and males to participate in this heated discussion. The idea of equality between genders was beginning to change for the better bit by bit. There were famous females who began to defy men and act upon their beliefs. Some wrote and published their views, others simply followed their dreams that men had taken away, and a few noblewomen used their wealth and status to influence things. The females showed that women were as good as men, whether they liked it or not. For instance, Isabelle d’Este was a noblewoman who was the Marchesa of Mantua. She was not only a patron of the arts, but [also] an inspiration to great artists [like Titian and Da Vinci]† (â€Å"Isabelle d’Este†). To name a few other women, there was the French writer Marie de Gournay, Venetian poet Lucrezia Marinella, and British playwright Aphra Behn (Nym Mayhall 46). These people tried to defend the reputation of women and show the excellence in females by creating literal works. Further women such as Italian Gaspara Stampa and French Louise Labes wrote poetry, romances, stories, novels, and plays (â€Å"Women† 326). Many other females wrote but compared to males, the published works were little. Yet, it’s the thought that counts. Women writers published their thoughts and opinions. Life in the English Renaissance was comparably challenging to that of our current life. There were more limitations and expectations for females. It would terrify most girls in this day and age to marry at such young ages and not even know who the groom is! What if he was twenty years older? Such things were one of the many worries of girls in the Renaissance, alongside with household chores and duties. It was all because of the chance of being born female. Four hundred years from the Renaissance, there is finally equality between both genders. Though there may sometimes be evidence of inferiority, overall females have the freedom to choose and decide what they want and never have to be restricted by rules. There is no need to fear the consequences of reading a book in public or disobeying one’s father in a matter of marriage.

Bullying: Effects On Social Anxiety And Self Esteem

Bullying: Effects On Social Anxiety And Self Esteem The present study documented measures of social anxiety and self esteem in adolescents and sought to determine its association with dimensions of bullying in victims. Social anxiety entails feelings of apprehension in social situations, while bullying involves recurrent and intentional acts like teasing to injure another and has been suggested in the occurrence of social anxiety. Self esteem refers to the general view of oneself and proposed as a link with bullying. An independent variable of this study is bullying while dependent variables are social anxiety and self esteem. Two hypotheses were yielded: (a) higher rates of bullying in victims were linked with social anxiety and (b) there is a relationship between bullying and self esteem. Eriksons developmental theory of Identity versus Role Confusion supported hypotheses of why bullying increased social anxiety and lowered self esteem in adolescent victims. Adolescents between ages of 12 and 20 completed self-report questionnaires on bullying, social anxiety and self esteem. Results proposed individuals who identified themselves as bullied victims had higher degrees of social anxiety and lower self esteem. Keywords: social anxiety, self esteem, adolescents, bullying, victims, erikson, developmental, identity, role confusion Chapter One: Introduction Before measuring the association between bullying, social anxiety and self esteem, it is crucial to be equipped with an understanding of the variables. Bullying With the intention of conducting investigations on bullying, researchers have to first determine what exactly is bullying As denoted by Marini, Spear and Bombay (1999), bullying is the manipulation of physical and emotional influence of deliberate harm towards a person, thereby producing a destructive environment instilling anxiety, threat and apprehension in an individual. Adding onto Marini et al.s (1999) definition, researchers who further assessed bullying indicated two different types namely direct and indirect. Direct bullying is portrayed as perpetual, existing as bodily assaults like kicking and hitting, while indirect bullying consists of behaviours such as teasing and intentional exclusion of an adolescent (Fitzpatrick et al., 2007; Haddow, 2006; Hampel, Manhold, Hayer, 2009; Nansel et al., 2001; Omizo et al., 2006; Raskauskas Stoltz, 2007). Social Anxiety An underlying characteristic of social anxiety is a phobia of social settings and interpersonal communication yielding self awareness and negative beliefs of oneself. Individuals suffering from social anxiety typically dread negative assessment by people (DSM-IV-TR; American Psychiatric Association, 2000). Based on Slee (1994), social anxiety has been unveiled to impact negatively on peer involvement, thereafter contributing to peer refusal. Self-Esteem Schaffer (1996) postulates self esteem as an assessment of an individual and the extent to which one perceives himself or herself as either optimistic or undesirable. Cooley (1902) proposed an understanding of oneself is shaped in accordance with peoples behaviour towards the self. Those who obtained positive views from others like a compliment would have increased self esteem. Onset of Bullying Bullying has evolved into a universal issue in adolescence. Several public findings by Cho, Hendrickson, Mock (2009) recognized bullying as multifaceted, producing a series of adverse societal, psychological and educational effects on adolescents. A justification for the rise of bullying occurrences in adolescence could be because of numerous progressive changes happening in this stage. Such changes include emotional ones like escalation in anxiety (Green, 2007; Nansel et al., 2001; Pergolizzi et al., 2007). Bulach, Fulbright and Williams (2003) theorized the manner in which bullying contributed significantly to the development of school violence. This was evidenced by an incident in 1998; Georgia, where an adolescent succumbed to death due to school bullying. The misfortune evoked awareness in the country where regulations on bullying were authorized. Hence, it is no wonder bullying is acknowledged as a prominent kind of violence in schools (Bulach et al., 2003; Olweus, 2003; Siris Osterman, 2004; Vossekuil, Fein, Reddy, Borum, Modzeleski, 2002). The following describes the influence of bullying on victims by highlighting the prevalence rates, thereafter introducing traits of victims and how these are linked with social anxiety and self esteem. Prevalence of Bullying Bullying is highly prevalent among adolescents and differs among cultures. It results in detrimental consequences and persists as a stumbling block in schools, where adolescents struggle to handle distress from bullying. National studies directed by Nansel et al (2001) demonstrated an approximate of 2,027,254 adolescents identified themselves as victims of temperate bullying while 1,681,030 youths engaged in repeated bullying. Reviews have generated an increasing interest on bullying in the 21st century (Rigby 2003; Arseneault et al. 2009), with adolescents of United States of America (USA) generating the highest distress from either forms of bullying. This is evident in a study, where an estimated 10% claimed to be bullies or victims at least once a month (Omizo, Omizi, Baxa, Miyse, 2006). A study by Olweus and Limber (1999) stated approximately 1.6 million of college adolescents in (USA) constituted bullied victims. Additionally, Nansel et al. (2001) uncovered 30% of them were linked with bullying, existing as a bully, victim or both. A separate statement by the U.S. Department of Education revealed 77% of adolescents whom were assessed were victims throughout their entire education (Garbarino et al., 2003). With bullying occurrences on the rise, researchers have thus commenced detailed examinations to further evaluate such occurrences in adolescence (Espelage Asidao, 2003). Since such elevated incidences of bullying are a cause for concern, it is vital to be mindful of different types of aggression and that bullying is just a specific kind. Despite majority of studies on issues of adolescent bullying for bullies and victims, only those pertaining to victims and the relation to social anxiety would be investigated. Attributes of Victims This group of adolescents are known as receivers of violence inflicted by their aggressors. Victims are more likely to appear timid, withdrawn and lack motor synchronization. Besides being known to have minute body sizes and regarded as undesirable by their peers (Bernstein and Watson, 1997), they have nervous disposition characterized by an intense worry of negative appraisal from people, (Bernstein Watson, 1997; Haynie et al., 2001), a trait of social anxiety. In addition, these victims display avoidance in social settings as a result of being bullied (Fitzpatrick, Dulin Piko, 2010; Ivarsson, Broberg, Arvidsson, Gillberg, 2005; Hampel et al., 2009). Olweus (1973, 1978) recognized victims exist in two groups; submissive and highly aggressive or provocative victims. The submissive ones are portrayed as vulnerable and do not incite bullies to further violence. Instead, they behave in ways that intensify the act. As submissive victims do not protect themselves, they are deemed weak, therefore undergoing peer refusal, an aspect of social anxiety. On the contrary, provocative victims exhibit restlessness and seem more irritable. They are likely to retaliate during assaults. Though all victims are highly susceptible of appraisal especially negative ones, submissive victims are more affected by such criticism and reproach themselves repeatedly. Highly aggressive victims portray nervous tendencies and difficulties focusing on tasks at hand, experiencing greater disregard compared to submissive victims. Victims and Social Anxiety Though anxiety is manifested in several forms, social anxiety is most palpable in bullied victims and acknowledged as a persistent disorder (Watson and Friend, 1969; as mentioned in Slee, 1994). Adolescents who suffered from childhood bullying may be at greater exposure to being bullied in school (Chapell et., 2004). Despite beliefs on bullying as uncommon in schools, a study has disputed such claims, indicating bullying rates as frequent across some colleges (Chapell et al.). A study was held on 1,025 university students where 60% claimed to have witnessed bullying and around 44% noticed a lecturer victimizing a student (Chappel et al.). This finding led Chapell and his team (2006) to further investigations, where a clear link regarding bullying occurrences in infancy, adolescence or both stages and chances of becoming victims in school was established. Their results are of considerable importance as it can assist some medical practitioners in treatment effects as they manage patients who might be bullied victims before. Social anxiety results in public aversion and restraint in affected individuals, reducing peer involvement due to a self belief of being undesirable by people (Ginsburg et al., 1998), therefore affecting peer communication which prolongs bullying and decreases their self esteem. This understanding was further developed as Crick and Bigbee (1998) noted adverse peer communication can affect ones self assessment, thus accounting for insufficient self esteem and exacerbates social anxiety. Investigators uncovered not all victims of bullying manifest social anxiety in adulthood (Hawker Boulton, 2000; Jantzer, Hoover, Narloch, 2006; Newman, Holden, Delville, 2005; Olweus, 1993; Schafer et al., 2004). However, regardless of their studies that bullying might suggest psychosocial issues during adolescence, there is still inadequate interest in the understanding of why only certain adolescents may experience such issues. Reviews (Chapell et al., 2004; Chapell et al., 2006) indicated adolescents who recalled being victims of bullying were at heightened possibilities of social anxiety in contrast with those who had no recollection. Such experiences pose worry particularly since bullying throughout adolescence has displayed a significant connection with higher emotional and interpersonal difficulties (Dempsey Storch, 2008; Hawker Boulton, 2000; Jantzer, Hoover, Narloch, 2006; Newman, Holden, Delville, 2005; Olweus, 1993; Schafer et al., 2004; Tritt Duncan, 1997). Further analyses on previous bullying occurrences in males who were weekly sufferers discovered that they regarded anxious tendencies as a result of being bullied (Gladstone, Parker, Malhi, 2006). Similarly, the ability to recall past episodes of attacks was known to influence its start, with adolescents who recollected their situation recording a hastened experience of anxiety conditions and greater unease in social settings as compared to those who failed to remember their traumatic experience (McCabe, Miller, Laugesen, Antony, Young, 2010). An analogous study revealed adolescents who were victims before displayed more negative perception of the public than non-bullied adolescents. This perception is an example noted in anxiety disorders (Hawker Boulton, 2003). Furthermore, bullying accounts have specified adolescents who were once victims had more inclination to display characteristics of social anxiety like phobia of negative appraisal from others and social avoidance (Dempsey Storch, 2008). In comparison with non-bullied adolescents, victims are known to experience elevated psychological and emotional suffering due to bullying episodes they faced in school. Research has suggested this intense distress would persist even in adulthood (Fekkes, Pijpers, Verloove-Vanhorick, 2003; Hampel et al., 2009; Solberg Olweus, 2003). Està ©vez, Murgui, and Musitu (2009) piloted a finding on psychological changes with regards to social anxiety and self esteem in 1,319 adolescents. It was revealed bullied victims manifested higher social anxiety and greater discontentment with life compared to bullies and those non-bullied. This was reinforced in bullied. This was reinforced in Fitpatrick et al.s (2010) review where low self esteem and high degrees of social anxiety were evident due to bullying occurrences. Graham and Bellmore (2007) formed a profile sheet for bullying by grouping it based on bullies, victims, bully-victims and those non-bullied. They discovered significant disparities of psychological changes in victims, bullies and non-bullied adolescents, where victims garnered the most scores for anxiety and least in self esteem. In contrast, bullies yielded the lowest degree of social anxiety and were extremely high on self esteem scores. Based on cross sectional information, a study on 226 adolescents with past occurrences of being bullies and victims was operated (Gladstone et al., 2006). Gladstone and his team focused on victims and their likelihood of displaying anxious tendencies in adulthood. Self reported measures were used to determine anxiety. Results depicted bullied victims had greater levels of social anxiety and suffer from insufficient self esteem. Furthermore, social anxiety was still constant in a notable percentage of victims, expanding current findings on the relationship between bullied victims and adverse effects they experience. Additional research on bullying was conducted by Menensi et al. (2009) which concentrated specifically on psychological influences of bullying on victims. This assessment indicated bullies engaged in threatening behaviours like violence while victims suffered from worrying symptoms including social anxiety. In Esbensen and Carsons (2009) four year analysis, based on the belief that bullying happens continuously which causes major psychological issues like social anxiety, a set of questions were devised to establish the outcome of bullied victims and bullies. An apparent disparity in bullying frequency was uncovered. A meagre 28% indicated themselves as victims in yes and no questions; whereas 82% admitted they were victims on questions inquiring personal development and behaviour. Victims faced with bullying on a constant basis also experienced increased social anxiety, higher possibilities of being harmed at school and a severe fear of being bullied, which was supportive of Menensi et al.s (2009) study. Bullying and Self-Esteem The effects of bullying are well documented in countless reviews, from lingering health issues to emotional distress and diminished self esteem. Self esteem is constituted by a series of beliefs an individual has (Berk, 2009). The relationship of bullied victims and low levels of self esteem is clear. This is apparent in Houbre et al.s (2006) report which implied a lack of self worth in victims who were seemingly displeased with their physical appearance. This negative self evaluation may cause victims to isolate themselves from the public, and this could result in mental health issues. Hence, it is significant to identify the connection between bullying and how it leads to low self esteem in victims. According to Hodges and Perry (1999), bullying serves as factors of self esteem and social anxiety. A co-relational study on 8,249 Irish adolescents indicated links between rates of bullying and esteem, where bullies garnered least self esteem and anxiety (OMoore Kirkham, 2001). A separate study directed by Rigby and Slee (1999) on bullying in adolescence revealed 48.8% of males and 62.5% of females who lacked self esteem suffered more negativity following an assault. As a result, they have lesser peer involvement and suffer from refusal, triggering weakened self esteem and isolation from social settings, a core aspect of social anxiety. Thus, as predicted, it appears that self esteem contributes notably to the domains of bullying as well as social anxiety. In a subsequent finding, Houbre, Tarquinio and Lanfranchi (2010) questioned if low self esteem was a determinant and outcome of bullying. Their study supported the idea of self esteem as a predictor of bullying based on results portraying pessimistic beliefs as the strongest indication of the act. In addition, further examination by them on repetitive bullying and self esteem described the extent to which both were connected; the lower the self esteem, the higher the occurrence of the attack. Apparently, bullying can reduce a victims self esteem. Despite victims possessing a likelihood of being bullied, such attacks decrease their self esteem and also exacerbate feelings of anxiety as they accept their aggressors beliefs. Thus, these findings imply that self esteem can exist as a cause of bullying and can also be influenced by it. Ample evidence regarding self esteem in bullying occurrences has been displayed before (Andreou, 2000; Callaghan Joseph, 1995; Ross, 1996). Boulton and Underwoods (1992) study unveiled a whopping 80% of adolescents claimed to experience more happiness and confidence in life before episodes of bullying commenced. This is further evidenced in Bosworth et als (1999) analysis on 558 students of a certain academic level, where low degrees of self esteem and higher bullying rates were linked. Moreover, victims of bullying were recognized to have lower self esteem in comparison with bullies and those not implicated (Andreou, 2000; Bolton Underwood, 1992). Hence, self esteem served as an originator and a result of bullying (Graham and Juvonen, 1998). In a precise finding by Graham and Juvonen (1998), it was noted that adolescents who perceived themselves as victims came across several social issues like low self esteem. This is in contrast with adolescents, who were identified as bullied v ictims by their peers, suffering from peer issues like refusal. Nansel et al.s (2001) research relating to self esteem and the capability to befriend others produced an unfavourable relationship with school bullying, but was surprisingly positively correlated with victimizing people. This is reasoned by Borgs (1998) study which stated male victims were extremely resentful and female victims were mainly unhappy. As feelings of resentment and unhappiness result in distress which affects victims self esteem, they may also be placed at heightened risks of being bullied (Hazler, 2000). In different reviews, the extent of bullying is considered an influence of an adolescents mental well being. This seems to imply anxious tendencies of an adolescent are likely to stem from bullying. This notion was supported by an examination on bullying as a correlation of decreased self esteem and elevated intensities of anxiety (Mynard, Joseph and Alexander, 2000). An exact finding by Mynard et al. (2000) purported oral bullying as a negative link with self esteem and that adverse outcomes of bullying may vary based on the extent of aggression applied. As a majority of adolescents are predisposed to intimidation by bullies, one possible reason for those who are more confident and less anxious would be their low acceptance of assaults by bullies as they attempt to protect themselves against harm, instead of the victims who fail to retaliate (Egan Perry, 1998). This explanation hence clarifies why only some adolescents who lack self regard and display social anxiety depict a phase of bullying. Several findings specified self esteem as a significant link to bullying and social anxiety, proposing that bullying incidents cause unfavourable effects on an individuals self esteem, thus justifying the high degrees of social anxiety according to them (Bernstein Watson, 1997; Fosse Holen, 2002; Kumpulainen, Rasanen and Henttonen, 1999; Kumpulainen Rasanen, 2000; Mahady-Wilton, Craig, Pepler, 2000; Marini, Spear Bombay, 1999; Nansel, Overpeck, Pilla, Ruan, Simons Morton, Scheidt, 2001; Perry, Kusal Perry, 1988; Rigby, 2000; Roecker Phelps, 2001).

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ÃŽ ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN ÃŽ ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ÃŽ ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN ÃŽ ² therapy.10 Therefore, cohorts of patients receiving IFN ÃŽ ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN ÃŽ ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNÃŽ ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNÃŽ ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNÃŽ ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value

Analysis of Nike Essay -- Nike Tennis Shoes Retail Businesses Essays

Analysis of Nike Basketball players â€Å"wanna be like Mike†, but shoe companies â€Å"wanna be like NIKE.† NIKE is the worlds #1 company and controls more than 40% of the US athletic shoe market. The company designs and sells shoes for just about every sport, including baseball, volleyball, cheerleading, and wrestling. NIKE also sells Cole Haan dress and casual shoes and a line of athletic wear and equipment, such as hockey sticks, skates, and timepieces. In addition, it operates NIKETOWN shoe and sportswear stores and is opening JORDAN in store outlets in suburban markets. NIKE sells its product to about 19,000 US accountants, in about 140 other countries, and online. Chairman, CEO, and co-founder Phil Knight owns. Nike Co. is very interesting, as well is a popular brand. Nike, pronounced NI-KEY, is the winged goddess of victory according to Greek mythology. She sat at the side of Zeus, the ruler of the Olympian pantheon, in Olympia. A mystical presence, symbolizing victorious encounters, NIKE presided over history’s earliest battlefields. A Greek would say, â€Å"When we go to battle, and win, we say it is NIKE.† Synonymous with honored conquest; NIKE is the twentieth century footwear that lifts the world’s greatest athletes to new levels of mastery and achievement. The NIKE â€Å"swoosh† embodies the spirit of the winged goddess who inspired the most courageous and chivalrous warriors at the dawn of civilization. Among artistic representations of Nike are the sculpture by Paeonius (c. 424 BC) and the â€Å"Nike of Samothrace.† Rhodians probably erected the latter, discovered on Samothrace in 1863 and now in the Louvre Museum, Paris, about 203 BC to commemorate a sea battle. Excavations have shown that the sculpture was placed alighting on a flagship, which was set in the ground in such a way that it appeared to float. If you were to break the word NIKE down, you would get Ni-key. The pronunciation for Nike is ‘nI-kE. Its function is noun, and its etymology is Greek NiKE. If you defined the word NIKE, you would find out that it means the Greek goddess of victory. Another meaning and definition of a word is SWOOSHING. Main entry: Swoosh, function is noun, and it is an act or instance of swooshing. The origin of the swoosh dates back as far as 1971. Phil Knight was supplementing his modest income from Blue Ribbon Sports Inc. by teachi... ...enior labor official reiterated complaints that workers in Nike-contracted factories faced inhumane treatment. ``Violations of labor rights generally are occurring in their smaller contractor joint venture or wholly-owned ventures in which the Vietnamese side has minimal control,'' said Tu Le, a senior official from the Vietnam Labor Union. Nguyen's report was to be released today in New York. Just weeks ahead of the report, Nike announced it had hired former U.N. Ambassador Andrew Young and his Goodworks International group to review a new code of conduct for the company's overseas factories. The measure was aimed at quelling mounting criticism that working conditions at factories in Indonesia and Vietnam were substandard. Nike uses five manufacturing plants in Vietnam, where it takes advantage of low-cost labor and relatively high production standards. About 3 percent of Nike's output is produced in Vietnam, a Nike spokesman said in an earlier interview. Michael Jordan became the first athletic mega businessman. His role as a spokesman for Nike turned that athletic-shoe and- apparel company into the world leader, earning both him and Nike millions of dollars. Analysis of Nike Essay -- Nike Tennis Shoes Retail Businesses Essays Analysis of Nike Basketball players â€Å"wanna be like Mike†, but shoe companies â€Å"wanna be like NIKE.† NIKE is the worlds #1 company and controls more than 40% of the US athletic shoe market. The company designs and sells shoes for just about every sport, including baseball, volleyball, cheerleading, and wrestling. NIKE also sells Cole Haan dress and casual shoes and a line of athletic wear and equipment, such as hockey sticks, skates, and timepieces. In addition, it operates NIKETOWN shoe and sportswear stores and is opening JORDAN in store outlets in suburban markets. NIKE sells its product to about 19,000 US accountants, in about 140 other countries, and online. Chairman, CEO, and co-founder Phil Knight owns. Nike Co. is very interesting, as well is a popular brand. Nike, pronounced NI-KEY, is the winged goddess of victory according to Greek mythology. She sat at the side of Zeus, the ruler of the Olympian pantheon, in Olympia. A mystical presence, symbolizing victorious encounters, NIKE presided over history’s earliest battlefields. A Greek would say, â€Å"When we go to battle, and win, we say it is NIKE.† Synonymous with honored conquest; NIKE is the twentieth century footwear that lifts the world’s greatest athletes to new levels of mastery and achievement. The NIKE â€Å"swoosh† embodies the spirit of the winged goddess who inspired the most courageous and chivalrous warriors at the dawn of civilization. Among artistic representations of Nike are the sculpture by Paeonius (c. 424 BC) and the â€Å"Nike of Samothrace.† Rhodians probably erected the latter, discovered on Samothrace in 1863 and now in the Louvre Museum, Paris, about 203 BC to commemorate a sea battle. Excavations have shown that the sculpture was placed alighting on a flagship, which was set in the ground in such a way that it appeared to float. If you were to break the word NIKE down, you would get Ni-key. The pronunciation for Nike is ‘nI-kE. Its function is noun, and its etymology is Greek NiKE. If you defined the word NIKE, you would find out that it means the Greek goddess of victory. Another meaning and definition of a word is SWOOSHING. Main entry: Swoosh, function is noun, and it is an act or instance of swooshing. The origin of the swoosh dates back as far as 1971. Phil Knight was supplementing his modest income from Blue Ribbon Sports Inc. by teachi... ...enior labor official reiterated complaints that workers in Nike-contracted factories faced inhumane treatment. ``Violations of labor rights generally are occurring in their smaller contractor joint venture or wholly-owned ventures in which the Vietnamese side has minimal control,'' said Tu Le, a senior official from the Vietnam Labor Union. Nguyen's report was to be released today in New York. Just weeks ahead of the report, Nike announced it had hired former U.N. Ambassador Andrew Young and his Goodworks International group to review a new code of conduct for the company's overseas factories. The measure was aimed at quelling mounting criticism that working conditions at factories in Indonesia and Vietnam were substandard. Nike uses five manufacturing plants in Vietnam, where it takes advantage of low-cost labor and relatively high production standards. About 3 percent of Nike's output is produced in Vietnam, a Nike spokesman said in an earlier interview. Michael Jordan became the first athletic mega businessman. His role as a spokesman for Nike turned that athletic-shoe and- apparel company into the world leader, earning both him and Nike millions of dollars.

Essay --

Anti-Terrorism in the UK The United Kingdom stands out from the world with its distinctive anti-terrorism policy, which gives the government extended powers to arrest, detain, and supervise those believed to be potential terrorists beyond what many other countries find suitable (Feikert & Doyle 2). The UK’s legislation surrounding terrorism is the product of policy that has evolved over time as the result of attacks taken out on the UK itself as well as global events that highlight the need for protection. The government has put together a thorough policy in response to terrorism, as well as preventative measures in an attempt to prevent such events from happening in the future. However, some measures taken by the government are seen by citizens and global critics to violate individual liberties and infringe on privacy. While the safety of its citizens is the prime motive of such policy, some people have been left to feel discriminated against in their own country. While the UK’s anti-terroris m policy is no doubt comprehensive, including measures to pursue, prevent, prepare, and protect the people from the threat of terrorism, the government is going to have to deal with the controversy regarding discrimination in order to satisfy its citizens and prevent future homegrown terrorist attacks. Terrorism is a difficult subject to tackle as it is hard to define. There is no collectively accepted definition in either the legal, civil, or academic sense of the word (Panter 579). The government of the UK defines terrorism as â€Å"the use or threat of action designed to influence the government or an international governmental organisation or to intimidate the public, or a section of the public; made for the purposes of advancing a political... ...ent needs to take this situation into consideration when creating laws, especially those that restrict the liberties of individuals. The UK’s unique style of government and policy history places it in a distinctive position compared to the rest of the world when it comes to counter terrorism measures. The government has created new policies over decades, which have been notable in their restriction of liberties and privacies of its citizens. It has become a controversy as to whether this should be allowed in order to protect the population as a whole or if these measures are a violation of human rights. Such policy is risky in that it might make some who feel discriminated against or disconnected turn to terrorism. While the UK’s anti-terrorism policy is detailed and comprehensive, it must take this into account and deal with the controversy in future legislation. Essay -- Anti-Terrorism in the UK The United Kingdom stands out from the world with its distinctive anti-terrorism policy, which gives the government extended powers to arrest, detain, and supervise those believed to be potential terrorists beyond what many other countries find suitable (Feikert & Doyle 2). The UK’s legislation surrounding terrorism is the product of policy that has evolved over time as the result of attacks taken out on the UK itself as well as global events that highlight the need for protection. The government has put together a thorough policy in response to terrorism, as well as preventative measures in an attempt to prevent such events from happening in the future. However, some measures taken by the government are seen by citizens and global critics to violate individual liberties and infringe on privacy. While the safety of its citizens is the prime motive of such policy, some people have been left to feel discriminated against in their own country. While the UK’s anti-terroris m policy is no doubt comprehensive, including measures to pursue, prevent, prepare, and protect the people from the threat of terrorism, the government is going to have to deal with the controversy regarding discrimination in order to satisfy its citizens and prevent future homegrown terrorist attacks. Terrorism is a difficult subject to tackle as it is hard to define. There is no collectively accepted definition in either the legal, civil, or academic sense of the word (Panter 579). The government of the UK defines terrorism as â€Å"the use or threat of action designed to influence the government or an international governmental organisation or to intimidate the public, or a section of the public; made for the purposes of advancing a political... ...ent needs to take this situation into consideration when creating laws, especially those that restrict the liberties of individuals. The UK’s unique style of government and policy history places it in a distinctive position compared to the rest of the world when it comes to counter terrorism measures. The government has created new policies over decades, which have been notable in their restriction of liberties and privacies of its citizens. It has become a controversy as to whether this should be allowed in order to protect the population as a whole or if these measures are a violation of human rights. Such policy is risky in that it might make some who feel discriminated against or disconnected turn to terrorism. While the UK’s anti-terrorism policy is detailed and comprehensive, it must take this into account and deal with the controversy in future legislation.

Polonius and Laertes Assist Hamlet :: Essays Papers

Polonius and Laertes Assist Hamlet 1. In his play, Hamlet, William Shakespeare uses various foils to make the play more complex. These foils involve numerous characters that help to develop different relationships and conflicts. Without these foils, the relationships and conflicts would not happen, and the play could not develop. They help us to understand Hamlet[']s actions and bring diversity to the play. Polonius and Laertes are the main foils for Hamlet. Polonius shows how irrational Hamlet thinks, and Laertes shows that Hamlet must pay for his actions, even if he is royalty. This plot and conflict develop from the similarities and differences between Hamlet and the foils. 2. Why are foils required to understand and develop the play? A foil is a minor character used to help develop or understand a major character. The foil must have some similarities with the major character in order to create a link with him. A foil must also be different in order to show or distinguish something about the major character. The foil does not always have an active role. Sometimes the foil is just someone for the major character to talk to. This allows his ideas to come through to the audience without a narrator; therefore, the foil is a kind of prop to help develop the role of the major character. Without a foil, there is no one to help develop or understand the major character, [;] thus his ideas cannot be revealed to the audience. Polonius was an important foil for Hamlet. 3. Polonius and Hamlet were similar in that they both loved Ophelia and tried to protect her. While Polonius died trying, Hamlet encouraged [?] her to go to a nunnery. Unfortunately, she died anyway. Also, Hamlet and Polonius both died trying to protect a woman. Polonius was trying to protect Ophelia from Hamlet, just as Hamlet was trying to protect his mother from Claudius. [Nice point] Both men were also loyal to a king--Polonius to Claudius, and Hamlet to his father. Here again, both kings were killed. 4. Polonius and Hamlet also had their differences. While Polonius was loyal to Claudius, Hamlet was not loyal or even respectful to him. Hamlet knew Claudius was a murderer and Polonius was not even suspicious of King Hamlet’s death. Although they both died, Polonius and Hamlet[']s murders were different.

Essay About Me, Planning and Career Essay

Born and name Nur Shahiera Binti Nor Adnan , I am the only daughter of Nor Adnan bin Mohd Nor and Azar binti Kamaluddin. I was born on 2nd May 1995 in Pahang. I am the eldest sister and also the only girl among six siblings. I stayed with family in Kuantan, is the state capital of Pahang. My father a business man and my mother a clerk in the department of works at Kuantan. I am from a humble. I was receiving early education at Tabika Kemas Kampung Cherok Paloh when at the age of 3 years up to 5 years old. After that, my parents transferred at Pra Sekolah Kebangsaan Cherok Paloh which does away with my home. I started my primary education at Sekolah Kebangsaan Cherok Paloh, is the school is located far from the city from 7 years old until 12 years old. During the year 2007, I took the UPSR examination and I passed with flying colours to score 3A 2B’s. I furthered my lower secondary education at SMK Sungai Soi, Kuantan and in the year 2008. This school made me independent and adaptable when I was given the responsibilities to become school prefect. When I was form one, I’ve been listed as one of the best student after I got 8A’s in first exam. The excellent results did not last to form 3 when my PMR results is so bad and I’ve 1A 6B with 1C. When I was in Form 4 and I was so active in co-curricular activities. I have represented the school in netball competition up to the district town. Besides, I also represent the school in competitions Quran recitation ceremony and won third place. I was also able to beat the students of Al Ihsan School of Religion. I’m so excited and happy with some successful. when I was being increased 5 I moved to SMK Ubai because the instruction out due to the results of the examination at the end of Form 4 so badly. I took my SPM examination in the year 2012 and as the result, I got 2A1B3C2E1G. I tried to mantain in some subjects but I failed. I failed checkers additional mathematics and simply pass in chemistry and physics. I highly regret this decision and make my parents disappointed. I as eldest daughter should show good results for my brothers. After school I was asked to participate in the group’s first Pusat Latihan Khidmat Negara at Kem Cahaya Gemilang Cherating, Kuantan. in PLKN I can learn to be a responsible citizen of the country. There also I was able to learn and recognize yourself in more detail. Besides that I also get to know the attitudes of students can excel in further education and to train yourself to be able to work in management. I  received offers from many colleges, but I’m only interested in a field which is at Poly-Tech Mara College of accounts field but my parents do not agree in their field so I suggest that in the field of human resource management. I finally received and have been filling out forms. I love my subjects of Geography Form 1 yet, so I’m trying to find a fi eld that is quite similar to the subjects. I’m interested to know the human population and the environment. So I chose Human Resource Management at Kolej Poly-Tech Mara in Kuantan. The Diploma in Human Capital Management focuses on core competencies, which integrates organization development and human resource content with an emphasis on strategic human capital and development. The programme offers combination of theory and practice which enables students to evaluate the ideas and relate them to the activities that take place in organizations. The programme also will equip students with the necessary skills to enter the market in the area of commerce, banking and manufacturing. I hope I can be a minister of human resources later like Dato Dr. S. Subramaniam. I plan to develop a workforce that is productive, informative, disciplined, caring and responsive to changing labor environment towards enhancing economic growth and increasing employment opportunities. in addition to developing a skilled workforce, knowledgeable and competitive in a harmonious industrial relations environment and social justice. Based on my recommendation, I must study more diligently in this area so that I can achieve my ambitions as an officer of the ministry of human resources. Managing international relations in the field of labor administration, technical cooperation in matters of labor and human resource development is one of the tasks and responsibilities of the ministry of human resources. I hope none of this corruption in the management. I wish and set a high hope that one day I will be able to be a minister of human resources. This is all about me, my education and career planning if I took human resource management as my primary choice to further my study. Despite of deep interest in this field, human resource management also serve a lot of golden opportunity in Malaysia, especially in the future. This job is not only about making money, but also mainly about how to improve my race level in this modernity lives. As this field is less monopolized by the Malay bumiputras, I think I’ve had the responsibility to help my own people. I will surely do anything to achieve my goals. Moreover, dentistry will be one  of rewarding career and surely people will start to look for a chance to get to know more about it.

Undecided Audience Outcome

Nikki Westerman En1420 Unit 2 assignment 1 Chapter review and trace 1. What are the five elements in the rhetorical situation? Use trace to help you remember. Answer: Text, Reader, author, constraints, Exigency. 2. How can a reader use the rhetorical situation to analyze an argument essay? The targeted readers are other students who have had or could have similar experiences. The author expects the students to identify with him and agree that such policies should be abolished.Other readers might include professors and administrators who would probably be less likely to agree with the author how a viewer cans use the rhetorical situation to analyze an image? The targeted viewers are people in the United States, but also in other parts of the world, who read this newspaper either online or in print. The photographer expects the audience to be interested in what is going on in Haiti in general, but also to show an interest in natural disasters of this sort.The photograph would expect a sympathetic audience who shares his humanitarian values. How can a writer use the rhetorical situation during the planning phase of writing a paper? As a writer you can use the rhetorical situation to help you think critically and make decisions about your own writing. 3. Why is the audience important in argument? T0 help give critical opinions what types of positions might an audience initially hold?A friendly audience, an undecided audience, a neutral audience, a hostile resistant audience an unfamiliar audience a linked audience. What possible outcomes are associated with arguments directed to each of these audiences the planned outcome is to confirm these audiences’ beliefs and strengthen their commitment. An undecided audience outcome can have final agreement with you anew interest in the issue and a commitment to work out a position on it. . What is discourse community? Audience’s affiliations. To what discourse communities do you belong? None how does a discours e community help establish common ground for its members? Monthly meetings 5. What is the universal audience? One who agrees on everything? What are the special qualities of the audience? There is none Why is it a useful idea? I didn’t find anything on this.

Pro Death Penalty – Essay

One main person involved was Susan Atkins an intelligent woman twisted by the ideas of Manson. She stabbed Sharon Tate, a pregnant actress, sixteen times, Sharon begged for mercy and Susan Atkins told her â€Å"there would be no compassion for her or her unborn bar, and after tasting the victim's blood she used the blood to write the word â€Å"pig† on the front door and left. After she admitted to stabbing the pregnant actress in her 1971 court trial, she was sentenced to the death penalty. BUT due to the Supreme Court decision in 1972 of abolishing the death penalty, Atkins was now In prison for life with POSSIBLE PAROLE!She Is now on the brink of death and has cost the state of California over 1. 4 million dollars alone in medical costs That's doesn't even include the 3. 5 million dollars it has took to care for her in prison for almost forty years! In total, this adds up to 5 million dollars The cost to keep the death penalty in California Is ninety million dollars. Right now California has 3,300 people in for a life sentence, this only adds up to the seventy five million dollars right now. But riddle me this with crime rates only moving up in these financially bad times do you want to run the risk of putting more in life in Jail? The costs here say.If we add one hundred people a year to the life In prison list It will only take seven years for the price of life penalties to be higher than the death penalty price! Now some people believe that sometimes the person that was accused didn't even commit the crime and that that person is being killed for no reason, but with modern technology today there Is a very unlikely chance of mixing a person up with the convict. One of the easiest ways to find out If the defendant Is the killer Is by using DNA testing to see if their DNA matches the convicted person, also besides DNA routs can use finger prints to identify the killer.Now even the person convicted isn't the killer there has been in the last few years a average waiting time on death row of 12 and 1/2 years with some men walling up to 25 years, that give the defendant and the government more than enough time to review the case and look for new evidence!!! But enough with costs of the death penalty, what is your moral view. People view the death penalty in many ways, some for it and others against it. But what It takes for ones opinion to be changed Is the death of someone you know or are Emily members with. Most seek revenge and want that person to die and experience what they did to the victim.Now what would you want a the killer of you dad or you mom, maybe you sister or brother to get? Life in prison or the death penalty. The murderer should have to face what their victim did! Now what do you really want? During life prison the prisoners can get a chance to have a education In prisons While we are paying for college and schooling they are getting a free education that 1 OFF we pa Rebuttal The plan proposed by the affirmative s ide will not work! While we are paying for allege and schooling prisoners can be getting a free education that we pay for with our tax!For the people locked up for life in prison. It's a university of crime where prisoners are schooled to be â€Å"better† criminals. The taxpayers pay the tuition. It costs more than a Harvard education. Prison is the breeding ground for the worst social evils. Remember that 35 out of the 50 states still support capital punishment! That is more than 70% of the states, that dost even include the U. S. Government that also supports capital punishment. Ohio also uses the death penalty. Also more than 62% f Americans still support the death penalty. That is way more than half!It also comes down to the view of the watcher, some people that don't support the death penalty haven't gotten to feel what it is like to have a brother or parent, child or friend killed. Many peoples view change when they are asked, † If someone you loved was murdered, would you still want them to have life in prison or do them deserve what they did? â€Å". Many people are hit hard by this question, but what would you want? To know that the murderer that killed a loved one gets the same thing that they did to the victim? Or to see them in prison possibly getting an education with our tax money!With DNA testing and the new advancements in forensics there is almost no chance that the accused is really not the killer. Some killers out there have killed seven people or more, and you really want them to get away with it? Than this is not the America our founding father based it on! People deserve the right to know that they don't have to go to bed worrying that the murderer that killed there loved one is out there not getting what they deserve! Just like in the courts of King Hamburg, The convicted deserves the eye for an eye tooth for a tooth treatment.The idea of abolishing the death penalty is corrupt and will ruin the system, many say that the de ath penalty cost more than life in prison, but if all the people on death row are put in for life in prison within 10 years the death penalty cost will look tiny compared to the price of life in prison. .Sam and Andrew are wrong! If we let people like them take control of society who knows? Maybe gay marriage will be legalized and a women can go and abort a baby, as if it is Just a regular part of their daily routine! Getting rid of the death penalty will ruin society!

Kindergarten and the 12 years of Elementary and Secondary Education

WTF WTF Katrina Angela Macapagal English 10 10 April 2013 No k in their K-12 Studying in a public elementary school and one of the largest public high schools in Mindanao, I have been immersed in a population of students from different walks of life after kindergarten. Yes, different walks of life. There were kids from extremely rich families and then there were the children of the poor as well. But in my section, an engineering science curriculum, three quarters of the class came from prominent wealthy families, children of provincial politicians, and owners of vast farm lands.And I belong to the remaining fourth of the section. If you take a peek in our class while we have our discussions, in every armchair, there is a seated a student with a thick book on top of the desk. We are always present in class, worried about our homework and doing our best to grasp the topics in advanced Math, Sciences and other electives. Unfortunately, that is not the case in the remaining 30 sections o f our year level which belong to the basic education curriculum (BEC). The real plight of public school students is resonated by the situation of these 30 sections in my year level.Every time I would enter their room, what always invites my attention is the absence of a large fraction of the students. In some rooms, it would seem that the class has a perfect attendance because all of the chairs are occupied, but that is not the real case. The section just simply lacks chairs making it easy for me to assume all the students are present. Also, the books they use in various subjects most especially in Science and Social Studies, provided by the government, contain massive errors in facts and lack the level of academic competitiveness suited for a senior high school.Every time I see documentations in the television about conditions of public schools, I always tell myself that we, the students of my school, are still lucky compared to those kids in remote regions across the archipelago, and even the students in urban areas like Metro Manila. I could not grasp the thought of having a class while my classmates and teachers’ feet are submerged in murky water. I could not imagine having a Science and Health class while all of us are sitting on the ice-cold floor. I could not bear the idea of learning while we are grilled under the scorching sun.I think I cannot survive my papers if our library lacks the wisdom it must possess. I believe we could not have a good class discussion if my teacher does not have the materials for teaching like chalks and pens. I think it would be hard having a class while your room is being used as a shelter for typhoon victims. And lastly, I could not imagine the younger students suffer from this kind of environment for two years more because of an immature and unprepared educational program implemented in an inappropriate haste.Despite such hindrances in achieving a quality education, the Department of Education (DepEd), under the au spices of President Aquino, still pursued the implementation of â€Å"Kindergarten and the 12 years of Elementary and Secondary education† otherwise known as K to12 program last school year 2012-2013. The implemented program added two more years in the old 10-year Basic Education Curriculum (BEC) of the country. Also, before reaching the elementary level, a child must have undergone the kindergarten education.In the K to 12 program, an optional one year pre-kindergarten course is offered, and once a child reaches 5 years old, he or she must be schooled in the mandatory kindergarten curriculum. By K to 12 definition, the elementary level consists of grades one to six, just like the old system. The drastic change is seen as the students go to high school which is now divided into two: the junior and senior high school. In junior high school, the students will spend four years, and two more years in the senior high school where the core subjects Math, Science, and Language will be strengthened.Specializations for the students will be offered to the students as well. The goal of the program is â€Å"to provide sufficient time for mastery of concepts and skills, develop lifelong learners, and prepare graduates for tertiary education, middle-level skills development, employment, and entrepreneurship,† (Official Gazette) a noble mission indeed, worthy of the Filipino people’s support. But the flaws in the way the government and the DepEd handled and will handle the implementation of the program leads to the bursting of the bubbles of hope in achieving a better educational system and producing high-caliber graduates.They succumbed easily to international pressure and rushed things which were supposed to be planned and funded with adequate budget. It is not the right time for K to 12. Before the K to 12 program started, The Philippines is one of the three countries in the world, and the only one in Asia, with only ten years of basic education along with Djibouti and Angola in Africa. Other countries have 11-14 years of basic and pre-university education. We have been left behind in terms of the numbers, but is that really the problem as of now?Pro K to 12 people always insist the fact that we are behind foreign countries in international tests because of the ten-year basic education curriculum. The Trends in International Mathematics and Science Study (TIMMS) conducted a test in 2008 which was participated by 25 countries, including the Philippines. The results showed that the country, despite the fact that the best students from science schools took the exam, was still 23rd in rank. Also, the scores the takers got were overwhelmingly below average.However, the examination was only taken by grade four and second year high school students. The number of years a student spent on BEC doesn’t dictate how high or low the score he or she would get in the test but it is the curricula and the upbringing during the early years that would greatly affect the performance of the student. Adding two years in the BEC will not do any better for the students, as long as the teaching in lower years is not mended. In K to 12, a student must be schooled in kindergarten before reaching the elementary level.This mandatory one year kindergarten is not as controversial as the additional two years in high school since there is a universal acceptance of the significance of pre-school education in the development of a child. Studies have shown that Early Childhood Care and Development (ECCD) is associated with better cognitive and social skills development. Students who have undergone ECCD tend to learn more and stay longer in school according to the Education for All Global Monitoring Report in 2005 (37) . Indeed, the one year kindergarten is an essential part of the implemented K to 12.But do we have an adequate number of Kindergarten teachers who have studied the field of early pedagogy to sufficiently give the needs of kindergarten pupils? In the urban areas, there is no problem with kindergarten education since it is accessible to all in their barangay centers, but how about in the mountainous regions? Every day, does the DepEd expect mothers to carry their five year-old children while they cross tens of rivers and rough terrains just to reach the kindergarten schools in the low-lands?And if the child did not go to kindergarten and is not allowed to be enrolled in the elementary level, is it the parents’ fault for not letting their kid go to pre-school because they have no access to it in their village at the top of the mountain? As long as we do not have the right budget allocation for this program, we could not vanquish these scruples in our educational system. Sadly, the program was hastily implemented while we still have doubts about the project allocation. Better planning with a slower pace and a higher budget for education is the solution for a program to come into fruition.It is no t the right time for K to 12. In the elementary level, the Mother Tongue-Based Multilingual Education is to be used as a method of teaching in grades one to three. Local languages are the modes of instruction but English and Filipino are still to be taught focusing on oral fluency. During grades four to six, both English and Filipino will be used as languages of instruction in various subjects. Also, Science will not be taught in grades one and two anymore and a spiral curriculum is to be followed.In a nutshell, this spiral curriculum is a method of covering too many topics at the same time without giving focus and priority to a specific area of study. Moreover, there would be fewer hours spent in school for a decongested academic workload, giving students more time to learn their lessons and have extra-curricular activities outside the classroom. Teaching the students with mother tongue is truly an effective way of instruction since in the early years of the children, they have alr eady, somehow, understood the language.But to use three languages in a very early level of grade one is similar to assuming that all of our students are fast learners, and the truth is that only a few of them are. This kind of teaching will just simply bring confusion to most students and might lead to a poorer performance. Incorporating the three languages must be gradual, not instantaneous. With the removal of Science in grades one and two curriculum, I, as a product of public school education, was shocked by this ridiculous idea because Science, in the first place, was not even taught to us public elementary students in grades one and two.Public school students like me only started to learn the parts of the plants and the planets of the solar system when we were in grade three. How could they remove something that doesn’t even exist beforehand? Instead of removing the non-existing Science subject, it must be included in the early years of elementary as well as in kindergar ten. Eschach and Fried argued that children naturally enjoy observing and thinking about nature; exposing students to science develops positive attitudes towards science and; early exposure to scienti? phenomena leads to better understanding of the scienti? c concepts studied later in a formal way (315). Regarding the spiral curriculum in science, teaching basic concepts of general sciences like biology, chemistry, physics, and earth science is highly applicable and attainable in preparing students in the rigorous approach of science in high school. But do we have a sufficient number of teachers? No. As of 2012, the Philippines still lack 61 510 teachers, which the government promised to hire by 2013 (Official Gazette).Once the DepEd have finished hiring all these teachers, are we sure that the younger students are learning science from a science teacher and not from a language teacher? This is one of the most common faults in our BEC in public schools and would most probably be pre valent in K to 12 because of the rush in hiring teachers. In K to 12, thinking skills is prioritized more than memory work and accumulation of facts, a goal so elusive if the teacher just reads a book aloud in the discussion without even asking the students to critically examine the topic because of the lack of mastery in the subject.Last point in the elementary level, is the shorter hours of every day classes. This means there would be more free time for schoolchildren, an opportunity for them to be engaged in child labor. Less hours allotted in school also means more possible time to be spent in the internet, video games, television, and all other factors that greatly affect the sound education of a 21st century kid. And let us not forget the fact that there are students who travel for hours every day just to go to school.The half-day of school every day is not worthwhile of all their efforts just to come to school, most especially those children who have to swim rivers and climb mountains daily. Seeing these flaws in the elementary level, it is not yet time for K to 12. After grade six, like in some private schools, a student would then go to grade seven, not in first year high school. It’s not only the level name that has changed but also the duration of high school and its division into two parts: the junior and senior high school, making up a total of six years.K to 12 promises to hone our high school students in the different areas of learning most especially in science and technical-vocational field to produce well-rounded graduates who could get jobs without getting a college degree in a university. Also, a spiral curriculum is to be followed to ensure â€Å"better† learning process for the students. In high school K to 12, the spiral curriculum, again, is to be applied. The learning of basics in elementary should not be continued in high school.Once a student reaches the secondary level, a layered approach should be undertaken to ensure mastery in the different branches of science. In a layered approach, per year level, there is a corresponding field of science to be studied; Earth Science in 1st year; Biology in 2nd year; Chemistry in 3rd year; and Physics in the 4th year. If the spiral curriculum is to be used again in high school, the focus of the students in a particular subject might be distracted because of a sudden halt in the topic and a rough transition to another branch of science in the next quarters of the school year.Adding two years in high school means two more years of suffering for the parents and the students. Yes, studying in a public high school is free but there are miscellaneous expenses that make â€Å"accessible education† an illusion for the poor. †Although public elementary education is free, school-related expenses like transportation fare, snacks, lunch, school supplies and other learning materials are beyond the financial capabilities of poor parents,† UNESCO said.Th ese expenditures result to a high dropout rate in schools. As a matter of fact, in the year 2010, 8% percent of students leave high school and the leading reasons are high cost of expenses, lack of interest, schools are very far, and looking for work (Roces and Genito). It is true that public education is not for everyone; it is only for the poor who can still sacrifice money amidst their hunger. Does prolonging this agony for the poor produce more graduates who have undergone a better curriculum? I doubt.As the years become longer, the number of school leavers becomes higher, not if the government would provide more facilities and services that could help our elementary and high school students in their everyday education. Out of every 100 Filipino schoolchildren enrolled every year, 66 will complete elementary education, 42 will finish high school but only 14 will earn a college degree, says the Center for Asia and the Pacific Studies. With this trend in the number of graduating s tudents from elementary until college, one could clearly see how poorly the government focuses in educating the youth.And now DepEd is imposing this K to 12 program without even addressing such problems in different levels. Before the implementation of K to 12, 42 students finish high school. With additional two years, it seems that DepEd expect a higher number of graduates in high school considering the current prioritization of the government to education. Taking into account all these insufficient preparations and strategies set by DepEd, it is more likely that K to 12 is bound to fail. We are not yet ready; it is not the right time for the program. If not now, when?It is when our government would give full support to the education of our youth; when one is to one becomes the ratio between the students and the high-caliber books in different subjects most especially in Language and Science; when students in the mountains need not to travel on foot for hours every day just to reac h the â€Å"nearby† school in the other mountains; when we have the right number of excellent teachers to provide the academic needs of our students; when we have already constructed the essential facilities such as classrooms, comfort rooms, tables, and chairs corresponding to the high population of students; when the class size becomes much smaller than today’s 50, 35-40 being the manageable size (Senate Economic Planning Office, 7); when the flaws in the curriculum of our current educational system are corrected to suit best the eternal search of our students for proficiency in the different fields of learning and global competitiveness and; when the government’s budget for education becomes higher than the current 2. 7% spending, preferably at least 6%2 of the Gross Domestic Product (UNESCO) or the share of education to the national budget would rise up to 20% which is the average spending of developing countries (World Bank). Knowing that K to 12 would cost as much as P150 billion, the Philippine government did not do any significant effort to increase the budget for education and while the program is being run, DepEd has been doing its preparations.With these kinds of arrangement being done to fulfill the goals of K to 12, one could clearly see that it is not the right time for the Philippines to add two years to its current 10-year BEC. In 2003, the South Asian country of Bhutan, which is much poorer than the Philippines, has undergone the transition from four-year BEC to six. Two years before this transition, Bhutan has increased its public expenditure for education to 5. 9% and in 2003, it rose up to as much as 7. 2 percent of the country’s GDP. Also, from an average class size of 39, it lowered down to 23 even with the additional two years in secondary education. This is a preparation that should serve as an inspiration for the Philippines’ K to 12, not hurried and given much planning.Truly, two years of extended BE C is another worry for parents and students but if the government would give an undying support to the education of children from kindergarten to high school, it is more likely that the additional two years will not lengthen the burden of the students but will strengthen their knowledge in technical-vocational and scientific fields. Adding two years to the BEC should not be treated by the government as just mere compliance to international standards on paper, but as an essential means of boosting the skills and knowledge of our students to produce graduates that could survive the grueling challenges of life after high school.With two years more, students will be exposed to the field of their interests, and will have a chance to be trained in their chosen elective that could give them a higher chance of having a job or business after finishing high school. TESDA could give examinations to graduating senior high school students to grant them a National Certificate, proof of a studentà ¢â‚¬â„¢s competence in the chosen tech-voc discipline. On the other hand, for the students with an unending pursuit of excellence in Science and Language, the senior high school is an avenue for them to hone their knowledge in the chosen elective. This could also serve as their pre-university education and might lead to the diminution of the number of years of taking up a course in universities like in other countries with K to 12. Good education is expensive but lack of education costs many times more,† this is clearly stated in the Philippine Education For All plan (7) but with the government’s actions in undertaking the K to 12 program, they are contradicting what is wisely expressed in their EFA plan. The state must prioritize education above all, thus giving much more budget for the training of our teachers, accumulation of better facilities, construction of more classrooms and schools in far-flung regions, printing of high quality textbooks, and distribution of sc hool supplies to the have-nots. When we have already fed the hunger of our famished educational system, then we are ready for K to 12, but not their K to 12. Works cited â€Å"Education for All Global Monitoring Report 2005: The Quality Imperative. † UNESCO. 2004. Web. April 2013 < http://unesdoc. unesco. org/images/0013/001373/137334e. pdf> â€Å"Functionally Literate Filipinos: An Educated Filipino. † National Action Plan to Achieve Education for all by the Year 2015. October 2005. Web. 7 April 2013. Haim, Eschach and Michael Fried. â€Å"Should Science be Taught in Early Childhood? † Journal of Science Education and Technology 14. 3 (2005): 315 TCNJ. Web. 8 April 2013. â€Å"K to 12: The Key to Quality Education? † Policy Brief. Senate Economic Planning Office. June 2011. Web. 6 April 2013. < http://www. senate. gov. h/publications/PB%202011-02%20-%20K%20to%2012%20The%20Key%20to%20Quality. pdf> Roces, Lilia and Deogracias Genito. â€Å"Basic Educatio n Information System (BEIS). † 2004. Web. 7 April 2013. < http://www. nscb. gov. ph/ncs/9thncs/papers/education_BEIS. pdf> â€Å"The K to 12 Basic Education Program. † Official Gazette. n. d. Web. 6 April 2013. ——————————————– [ 1 ]. Refers to the 155 member countries of the United Nations Educational, Scientific and Cultural Organization (UNESCO). [ 2 ]. Reflected in the Senate Economic Planning Office’s report â€Å"K to 12: The Key to Quality Education? †